Your Perfect Assignment is Just a Click Away
We Write Custom Academic Papers

100% Original, Plagiarism Free, Customized to your instructions!

glass
pen
clip
papers
heaphones

BIOLOGY ASSIGNMENT

BIOLOGY ASSIGNMENT

BIOLOGY ASSIGNMENT (DEADLINE ASAP)
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).

2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)

3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.

image3.png

4. Click the region below the box marked “Start MultiAlin’. This starts your comparison

5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE. SAME COLOR MEANS THEY ARE SIMILAR.

6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.

7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.

8. Click the “Start MultiAlin” just like before.

9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?

10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.

11. Or… at the bottom of the image page, there is a command — “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.

COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)

image2

There are 3 genes below… they start with the > symbol…

>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434

TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG

GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA

CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC

AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC

TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT

GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT

GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA

CCACTGAAACCGCCCCCGCACCAGGGACTCCTGCCCGCGGCCCCCGCATGACACCCAGCGACCTGCGCAA

CCTCGACGAGCTGGTGAGGGAGATTCTGGGCCGCTGCACCTGCCCTGACCAGTTTCCCATGATCAAGGTC

TCAGAGGGGAAGTACCGTGTGGGGGACTCGAGCCTGCTCATCTTTGTGCGGGTGCTGAGGAGCCACGTGA

TGGTGCGAGTGGGTGGTGGCTGGGACACGCTGGAGCATTACCTGGACAAGCACGACCCGTGCCGCTGCTC

CTCCACTGCTCATCGCCCACCCCAGCCGAGGGTCTGCACCTTTTCTCCACAGAGGGTGTCGCCCACCACC

>gi|21961309|gb|BC034582.1| Homo sapiens keratin associated protein 3-2, mRNA (cDNA clone MGC:34106 IMAGE:3909612), complete cds

Order Solution Now

Our Service Charter

1. Professional & Expert Writers: I'm Homework Free only hires the best. Our writers are specially selected and recruited, after which they undergo further training to perfect their skills for specialization purposes. Moreover, our writers are holders of masters and Ph.D. degrees. They have impressive academic records, besides being native English speakers.

2. Top Quality Papers: Our customers are always guaranteed of papers that exceed their expectations. All our writers have +5 years of experience. This implies that all papers are written by individuals who are experts in their fields. In addition, the quality team reviews all the papers before sending them to the customers.

3. Plagiarism-Free Papers: All papers provided by I'm Homework Free are written from scratch. Appropriate referencing and citation of key information are followed. Plagiarism checkers are used by the Quality assurance team and our editors just to double-check that there are no instances of plagiarism.

4. Timely Delivery: Time wasted is equivalent to a failed dedication and commitment. I'm Homework Free is known for timely delivery of any pending customer orders. Customers are well informed of the progress of their papers to ensure they keep track of what the writer is providing before the final draft is sent for grading.

5. Affordable Prices: Our prices are fairly structured to fit in all groups. Any customer willing to place their assignments with us can do so at very affordable prices. In addition, our customers enjoy regular discounts and bonuses.

6. 24/7 Customer Support: At I'm Homework Free, we have put in place a team of experts who answer to all customer inquiries promptly. The best part is the ever-availability of the team. Customers can make inquiries anytime.